bcip nbt color development substrate promega  (Bio-Rad)

Journal: iScience

Article Title: Tat-fimbriae (“tafi”): An unusual type of haloarchaeal surface structure depending on the twin-arginine translocation pathway

doi: 10.1016/j.isci.2025.111793

Figure Lengend Snippet:

Article Snippet: BCIP/NBT Color Development Substrate , Promega , S3771.

Techniques: Virus, Recombinant, Plasmid Preparation, Purification, Software, Membrane

Journal: Cancer cell

Article Title: Liver Cancer Initiation Requires p53 Inhibition by CD44-Enhanced Growth Factor Signaling

doi: 10.1016/j.ccell.2018.05.003

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ™ ) ImmPRESS ™ HRP (Peroxidase) Polymer Kit Vector Laboratories Cat# MP-2400 ImmPACT DAB Peroxidase (HRP) Substrate Vector Laboratories Cat# SK-4105 NE-PER ™ Nuclear and Cytoplasmic Extraction Reagents Thermo Scientific Cat# 78833 DIG RNA Labeling Kit Roche Cat# 11175025910 In Situ Hybridization m Mdm2 probe ACDbio/Biotechne Cat# 447641 RNAscope 2.5 HD Assay kit- BROWN ACDbio/Biotechne Cat# 322310 Super Script VILO cDNA synthesis kit Thermo Scientific Cat# 11754050 RNeasy Mini Kit Qiagen Cat# 74104 SsoAdvance SYBR Green Supermix Biorad Cat# 1725275 BCIP/NBT Color Development Substrate Promega Cat# S3771 Experimental Models: Cell Lines Dih10 The Karin Laboratory ( He et al., 2013 ) N/A DihXY The Karin Laboratory ( He et al., 2010 ; Shalapour et al., 2017 ) N/A Experimental Models: Organisms/Strains Mouse: C57BL/6 Charles River Laboratories Strain Code: 027 Mouse: Cd44 −/− The Jackson Laboratory Stock# 005085 Mouse: p53 F/F Anton Berns ( Budanov and Karin, 2008 ) (Jonkers et al., 2001) N/A Mouse: p21 −/− The Jackson Laboratory Stock# 016565 Mouse: Cd44 F/F This paper, Peter Herrlich (FLI, Germany) N/A Mouse: Albumin-Cre The Jackson Laboratory Stock# 003574 Mouse: EGFR F/F Maria Sibilia ( Lanaya et al., 2014 ) N/A Mouse: Mx1Cre Maria Sibilia ( Lanaya et al., 2014 ) N/A Mouse: MUP-uPA Eric P. Sandgren ( Weglarz et al., 2000 ) N/A Mouse: Tak1 ΔHep Ekihiro Seki ( Inokuchi et al., 2010 ) N/A Oligonucleotides ChIP Primer, m Cd44 promoter, forward: ATGGGCTGGATTTCCACATA This paper N/A ChIP Primer, m Cd44 promoter, reverse: CCTTTCTCCTCCCAGTCTCC This paper N/A ChIP negative control Primer, m Cd44 promoter, forward: GACTTCTCCCCCTTTTCTGC This paper N/A ChIP negative control Primer, m Cd44 promoter, reverse: GCACCTAACCTTCCCTGGTT This paper N/A ChIP Primer, m c-Fos promoter, forward: TCTGCCTTTCCCGCCTCCCC ( Kinjyo et al., 2006 ) N/A ChIP Primer, m c-Fos promoter, reverse: GGCCGTGGAAACCTGCTGAC ( Kinjyo et al., 2006 ) N/A ChIP Primer, m Gapdh promoter, forward: TTGAGCTAGGACTGGATAAGCAGGG This paper N/A ChIP Primer, m Gapdh promoter, reverse: GTCCGTATTTATAGGAACCCGGATGGTG This paper N/A Primers for analysis of gene-expression changes, see Table S2 The Karin Laboratory N/A Recombinant DNA mCD44 cDNA Open biosystems/Dharmacon Clone ID# 4910789 Cat # MMM1013-202766790 Software and Algorithms GraphPad Prism 7.0 software GraphPad Software, Inc. www.graphpad.com/scientific-software/prism/ R software version 3.3.2 R Foundation for Statistical Computing, Vienna, Austria http://www.r-project.org Image Studio Lite Software LI-COR www.licor.com Adobe Illustrator CS6 Adobe www.adobe.com Open in a separate window KEY RESOURCES TABLE Quantitative Real-Time PCR Analysis RNA samples were prepared using RNeasy kit (Qiagen# 74104).

Techniques: Recombinant, Blocking Assay, In Situ, TUNEL Assay, Plasmid Preparation, Amplification, Staining, Labeling, In Situ Hybridization, RNAscope 2.5 HD Assay, SYBR Green Assay, Negative Control, Software